Modification

Crispr generated targeted CTCF point mutations

CTCF-mZF9-11 mutant was generated replacing endogenous CTCF exons 7 to 10 with a cDNA carrying point mutations in ZF 9, 10 and 11 (as shown in the authors' previous paper Nakahashi et al., 2013). A single sgRNA (CTGCGACAAGACCTTCCGCC) cloned in px330 vector and a DNA donor vector were introduced into CH12. The donor vector included 500-1500 bp homology arms and a PGK Puromycin cassette to select for targeted clones. After 36h cells were treated with puromycin (0.8 ug/mL, Sigma). The day after puromycin was wash out and limiting dilution was performed in fresh media. Individual clones were picked and genomic DNA was extracted (Biotool). Genotyping and sequencing were done by PCR using several locus-specific pairs of primers: For1: ATGAGAAGCGCTTCAAGTGTGAC, Rev1: TACTCTCAGCCTACTCAAGTCAT, For2: TCAGGAGCGGCACATGATCAT, Rev2: TGTAACTGAAGATCAAGTGTGTGCT