{"lab": {"@id": "/labs/4dn-dcic-lab/", "title": "4DN DCIC, HMS", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "correspondence": [{"contact_email": "cGV0ZXJfcGFya0BobXMuaGFydmFyZC5lZHU=", "@id": "/users/fb287a31-e765-41c5-8c1d-665f8e9f025b/", "display_title": "Peter Park"}], "status": "current", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"center_title": "DCIC - DCIC", "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "@id": "/awards/1U01CA200059-01/", "project": "4DN", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "description": "DCIC: The goals of the 4D Nucleome (4DN) Data Coordination and Integration Center (DCIC) are to collect, store, curate, display, and analyze data generated in the 4DN Network. We have assembled a team of investigators with a strong track record in analysis of chromatin interaction data, image processing and three-dimensional data visualization, integrative analysis of genomic and epigenomic data, data portal development, large-scale computing, and development of secure and flexible cloud technologies. In Aim 1, we will develop efficient submission pipelines for data and metadata from 4DN data production groups. We will define data/metadata requirements and quality metrics in conjunction with the production groups and ensure that high-quality, well- annotated data become available to the wider scientific community in a timely manner. In Aim 2, we will develop a user-friendly data portal for the broad scientific community. This portal will provide an easy-to-navigate interface for accessing raw and intermediate data files, allow for programmatic access via APIs, and will incorporate novel analysis and visualization tools developed by DCIC as well as other Network members. For computing and storage scalability and cost-effectiveness, significant efforts will be devoted to development and deployment of cloud-based technology. We will conduct tutorials and workshops to facilitate the use of 4DN data and tools by external investigators. In Aim 3, we will coordinate and assist in conducting integrative analysis of the multiple data types. These efforts will examine key questions in higher-order chromatin organization using both sequence and image data, and the tools and algorithms developed here will be incorporated into the data portal for use by other investigators. These three aims will ensure that the data generated in 4DN will have maximal impact for the scientific community.", "name": "1U01CA200059-01", "@type": ["Award", "Item"], "status": "current", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "notes": "Old Target: 4042d90e-9805-4819-bb05-6bf2ce3eda05", "status": "released", "aliases": ["4dn-dcic-lab:Vian-modification-CH12-CTCF-mZF9-11"], "guide_rnas": ["CTGCGACAAGACCTTCCGCC"], "description": "CTCF-mZF9-11  mutant was generated replacing endogenous CTCF exons 7 to 10 with a cDNA carrying point mutations in ZF 9, 10 and 11 (as shown in the authors' previous paper Nakahashi et al., 2013). A single sgRNA (CTGCGACAAGACCTTCCGCC) cloned in px330 vector and a DNA donor vector were introduced into CH12. The donor vector included 500-1500 bp homology arms and a PGK Puromycin cassette to select for targeted clones. After 36h cells were treated with puromycin (0.8 ug/mL, Sigma). The day after puromycin was wash out and limiting dilution was performed in fresh media. Individual clones were picked and genomic DNA was extracted (Biotool). Genotyping and sequencing were done by PCR using several locus-specific pairs of primers: For1: ATGAGAAGCGCTTCAAGTGTGAC, Rev1: TACTCTCAGCCTACTCAAGTCAT, For2: TCAGGAGCGGCACATGATCAT, Rev2: TGTAACTGAAGATCAAGTGTGTGCT", "date_created": "2018-11-27T16:43:34.086121+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2019-11-25T02:46:36.791021+00:00"}, "target_of_mod": [{"display_title": "Ctcf mouse gene", "@type": ["BioFeature", "Item"], "uuid": "d9c1b491-a1d8-4b93-9d33-fce884c4257e", "@id": "/bio-features/d9c1b491-a1d8-4b93-9d33-fce884c4257e/", "status": "released", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "point mutation", "public_release": "2019-11-25", "schema_version": "2", "project_release": "2019-11-25", "modification_type": "Crispr", "override_modification_name": "Crispr generated targeted CTCF point mutations", "@id": "/modifications/b926a8eb-c25a-4e89-9dad-fb886c2da932/", "@type": ["Modification", "Item"], "uuid": "b926a8eb-c25a-4e89-9dad-fb886c2da932", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "Crispr generated targeted CTCF point mutations", "external_references": [], "modification_name": "Crispr generated targeted CTCF point mutations", "modification_name_short": "Crispr generated targeted CTCF point mutations", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}